Top » Catalog » J2 » HU202

$18.00

HU202
[HU202]

HU202
hg38 Position: ChrY:14156448..14156448
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU202_F TTGCCTACACTCCCTTCACC
Reverse Primer: HU202_R AACGTCTCAAGAGGCAGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15895
1 x Y20053
1 x Y13343
1 x PF7372
1 x A12380
1 x A24025
1 x A19150
1 x FGC35464
1 x A22122
1 x A16362
1 x PF7381
1 x FGC4993
1 x Y15234
1 x PF4908
$252.00
Haplogroup Info
Other products
Currencies