Top » Catalog » J2 » HU202

$18.00

HU202
[HU202]

HU202
hg38 Position: ChrY:14156448..14156448
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU202_F TTGCCTACACTCCCTTCACC
Reverse Primer: HU202_R AACGTCTCAAGAGGCAGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies