Top » Catalog » J2 » HU206

$18.00

HU206
[HU206]

HU206
hg38 Position: ChrY:15301711..15301711
Ancestral: G
Derived: A
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU206v2_F CATGATTGTGAGGCCTTCC
Reverse Primer: HU206v2_R GCAGTTGCAAAGGTCACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16923
1 x FGC16561
1 x FGC30649
1 x J2a-PF5197 Panel
1 x PF5174
1 x FGC35495
1 x Y16934
1 x FGC36482
1 x PF5350
1 x FGC6748
1 x Y9005
1 x Y22037
1 x Y3620
1 x FGC5956
1 x L531
1 x J2-Y12007 Autrata Panel
1 x FGC21080
1 x Y14678
1 x FGC32617
$700.00
Haplogroup Info
Other products
Currencies