Top » Catalog » J2 » HU206

$18.00

HU206
[HU206]

HU206
hg38 Position: ChrY:15301711..15301711
Ancestral: G
Derived: A
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU206v2_F CATGATTGTGAGGCCTTCC
Reverse Primer: HU206v2_R GCAGTTGCAAAGGTCACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies