Top » Catalog » J2 » HU208

$18.00

HU208
[HU208]

HU208
hg38 Position: ChrY:15464111..15464111
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU208_F TAGGGCCATTGAAACCACTC
Reverse Primer: HU208_R CTCCTGGGTTCAAGCAATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A5699
1 x FT84198
$36.00
Haplogroup Info
Other products
Currencies