Top » Catalog » J2 » HU208

$18.00

HU208
[HU208]

HU208
hg38 Position: ChrY:15464111..15464111
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU208_F TAGGGCCATTGAAACCACTC
Reverse Primer: HU208_R CTCCTGGGTTCAAGCAATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6747
1 x J2a-L24 Panel
1 x A15507
1 x A17934
1 x FGC20435
1 x Y16841
1 x Y13373
1 x FGC32480
1 x A23494
1 x BY25020
1 x CTS6804
1 x FGC32752
1 x FGC29947
1 x FGC30363
1 x FGC6759
1 x FGC32507
$358.00
Haplogroup Info
Other products
Currencies