Top » Catalog » J2 » HU209

$18.00

HU209
[HU209]

HU209
hg38 Position: ChrY:15918781..15918781
Ancestral: C
Derived: A
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU209_F CCTCAACACATGGGAATATGG
Reverse Primer: HU209_R ACCTGTGGCATTTGGTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y20900
1 x PAGES00055
1 x S23560
1 x Y15053
1 x FT83405
1 x FGC32141
1 x PF5137
1 x BY55896
1 x Y23522
1 x Y12599
1 x FGC5877
1 x Y12389
1 x M158
1 x FGC53813
1 x FGC21348
1 x SK1318
1 x PF5366
$306.00
Haplogroup Info
Other products
Currencies