Top » Catalog » J2 » HU212

$18.00

HU212
[HU212]

HU212
hg38 Position: ChrY:16476384..16476384
Ancestral: C
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU212_F CAGCAATGGTCCACACAGAC
Reverse Primer: HU212_R TCCCAAAGTGTTGGGGTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y997
$18.00
Haplogroup Info
Other products
Currencies