Top » Catalog » J2 » HU213

$18.00

HU213
[HU213]

HU213
hg38 Position: ChrY:16559743..16559743
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU213_F TGCTGGACTGAATCAAGGTG
Reverse Primer: HU213_R ACTGAAAAGAGGCCACAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y20900
1 x PAGES00055
1 x S23560
1 x Y15053
1 x FT83405
$90.00
Haplogroup Info
Other products
Currencies