Top » Catalog » J2 » HU214

$18.00

HU214
[HU214]

HU214
hg38 Position: ChrY:19062326..19062326
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU214_F ATGTGGATCGGTCTGAGGAG
Reverse Primer: HU214_R TTCTCAAACGGTGTGATTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32592
1 x FGC45440
1 x CTS11100
1 x Y13675
1 x A24021
1 x L227
1 x HU198
1 x PF5183
1 x Y11291
1 x BY45500
1 x BY140494
1 x A25167
$216.00
Haplogroup Info
Other products
Currencies