Top » Catalog » J2 » HU219

$18.00

HU219
[HU219]

HU219
hg38 Position: ChrY:19868607..19868607
Ancestral: A
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU219_F AAATTGCCAACCCAGAAAAC
Reverse Primer: HU219_R CAGCTAGCCAGTGAGACTCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15163
1 x A17940
1 x PH185
1 x Y20573
1 x Y13374
1 x A24023
1 x A24017
1 x FGC45021
1 x P244.2
1 x FGC32608
1 x HU202
1 x FGC6741
1 x FGC6750
1 x SK1392
1 x FT19636
1 x Y14572
1 x BY64505
$306.00
Haplogroup Info
Other products
Currencies