Top » Catalog » J2 » HU220

$18.00

HU220
[HU220]

HU220
hg38 Position: ChrY:2915835..2915835
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU220_F AGGAGAAGGAAGAGCAACTCC
Reverse Primer: HU220_R AAACGTTCTCAAGTTTCAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies