Top » Catalog » J2 » HU220

$18.00

HU220
[HU220]

HU220
hg38 Position: ChrY:2915835..2915835
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU220_F AGGAGAAGGAAGAGCAACTCC
Reverse Primer: HU220_R AAACGTTCTCAAGTTTCAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30635
1 x FGC52332
1 x FGC35005
1 x HU203
1 x FGC9962
1 x Y14313
1 x SK1361
1 x L27
1 x M137
1 x Y7292
1 x Y13626
1 x Y16913
1 x A16315
1 x SK1323
1 x Y23457
1 x SK1328
1 x Y22055
1 x Y15170
1 x FGC5906
1 x L534
1 x HU220
1 x PF5169
$396.00
Haplogroup Info
Other products
Currencies