Top » Catalog » J2 » HU225

$18.00

HU225
[HU225]

HU225
hg38 Position: ChrY:7927778..7927778
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU225_F TTGCCTTAAGCCTTGTGATG
Reverse Primer: HU225_R GGTCCAGCACCCTAATGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15933
1 x PF5119
1 x Y16839
$54.00
Haplogroup Info
Other products
Currencies