Top » Catalog » J2 » M102

$18.00

M102
[M102]

M102
hg38 Position: ChrY:19764226..19764226
Ancestral: G
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2b
Comments: B9.101
Forward Primer: M102_F AAACTGGGACACTTGTAATGAAT
Reverse Primer: M102_R GTTTTTTGAGTCCTTGTTTATTCTT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies