Top » Catalog » J2 » M102

$18.00

M102
[M102]

M102
hg38 Position: ChrY:19764226..19764226
Ancestral: G
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2b
Comments: B9.101
Forward Primer: M102_F AAACTGGGACACTTGTAATGAAT
Reverse Primer: M102_R GTTTTTTGAGTCCTTGTTTATTCTT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT69031
1 x Y16821
1 x Y4036
1 x FGC32615
1 x Y15245
1 x CTS6521
1 x Y12605
1 x Y966
1 x Y13534
1 x Y14715
1 x Y14594
1 x PH3081
1 x J2a-L271 Segregation Panel
1 x BY132829
1 x Y12005
1 x FGC6726
1 x Y3612
1 x Y14699
1 x Y12937
1 x Y12601
$523.00
Haplogroup Info
Other products
Currencies