Top » Catalog » J2 » A16313

$18.00

A16313
[A16313]

A16313
hg38 Position: ChrY:8885404..8885404
Ancestral: A
Derived: G
Reference: Judith Simon (2017)
ISOGG Haplogroup: J2
Comments: Below Y9005
Forward Primer: A16313_F TCATCTGGAAAGGGAAGGTG
Reverse Primer: A16313_R GGAGTCAATTGGTGATGTCTTG
Reviews

Customers who bought this product also purchased
A16314
A16314
A16316
A16316
A16315
A16315
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y20900
$18.00
Haplogroup Info
Other products
Currencies