Top » Catalog » J2 » A16314

$18.00

A16314
[A16314]

A16314
hg38 Position: ChrY:13787616..13787616
Ancestral: C
Derived: T
Reference: Judith Simon (2017)
ISOGG Haplogroup: J2
Comments: Below Y9005
Forward Primer: A16314_F GCTCCTTTCTTCACCTGTGG
Reverse Primer: A16314_R CATTTCTGAGGGCATGGAAG
Reviews

Customers who bought this product also purchased
A16316
A16316
A16315
A16315
A16313
A16313
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies