Top » Catalog » J2 » CTS494

$18.00

CTS494
[CTS494]

CTS494
hg38 Position: ChrY:6927522..6927522
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2b (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS494_F TTGGGTCACTGAAACTTCTGC
Reverse Primer: CTS494_R ACAACACCAACAGCACCTTTC
Reviews

Customers who bought this product also purchased
Z1825
Z1825
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies