Top » Catalog » J2 » S5061

$18.00

S5061
[S5061]

S5061
hg38 Position: ChrY:3049411..3049411
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2b2a1a (not listed)
Comments: Approx. Z1297
Forward Primer: S5061_F GTGAGTGAGGACATTTCTTGTCC
Reverse Primer: S5061_R TCCAACGCAGTACATCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y20900
1 x PAGES00055
$36.00
Haplogroup Info
Other products
Currencies