Top » Catalog » J2 » A17063

$18.00

A17063
[A17063]

A17063
hg38 Position: ChrY:17228961..17228961
Ancestral: C
Derived: T
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Downstream Y13373
Forward Primer: A17063_F ACACGTGGCTGACCACAAG
Reverse Primer: A17063_R TTGGAAACAGAATTCATCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19114
1 x A11525
1 x Y14698
1 x FGC6756
1 x A18941
1 x BY32788
1 x L530
1 x Y17052
1 x Y17020
$162.00
Haplogroup Info
Other products
Currencies