Top » Catalog » J2 » BY24003

$18.00

BY24003
[BY24003]

BY24003
hg38 Position: ChrY:14776946..14776946
Ancestral: T
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: J2a
Comments: Downstream Z39478 (xP81)
Forward Primer: BY24003_F AGAATATCTTGCTTTGCTTTCTGAG
Reverse Primer: BY24003_R GAAATAGTTCACCGAATTTAACTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies