Top » Catalog » J2 » FGC30266

$18.00

FGC30266
[FGC30266]

FGC30266
hg38 Position: ChrY:5005054..5005054
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J2a1 (not listed)
Comments: .
Forward Primer: FGC30266_F GACACTCTTATAGATCTAGGATACGATGTG
Reverse Primer: FGC30266_R AAAAGATCTGAGTGGATACATGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15163
$18.00
Haplogroup Info
Other products
Currencies