Top » Catalog » J2 » FGC30306

$18.00

FGC30306
[FGC30306]

FGC30306
hg38 Position: ChrY:3015692..3015692
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J2a
Comments: .
Forward Primer: FGC30306_F ACTCCGCCTTCTCATTATGG
Reverse Primer: FGC30306_R GCCCTGTCTCAGATATTCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6752
1 x Y24651
1 x Y17051
1 x S18579
$72.00
Haplogroup Info
Other products
Currencies