Top » Catalog » J2 » Y36182

$18.00

Y36182
[Y36182]

Y36182
hg38 Position: ChrY:16996233..16996233
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: J2
Comments: Below Y13511
Forward Primer: Y36182_F CCTTGGAGTGGAATGAGGTC
Reverse Primer: Y36182_R CCCTGGTGCTAAAAAGGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S21050
1 x Y7698
1 x Y48488
$54.00
Haplogroup Info
Other products
Currencies