Top » Catalog » J2 » BY25020

$18.00

BY25020
[BY25020]

BY25020
hg38 Position: ChrY:7685356..7685356
Ancestral: G
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: J2a
Comments: Below L25 > Z38752 > Z38742
Forward Primer: BY25020_F AGGAAGGGAGAGAGAGTGATAGG
Reverse Primer: BY25020_R CAAACCAGCAACTGTCCACAG
Reviews

Customers who bought this product also purchased
YFS4537968
YFS4537968
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies