Top » Catalog » J2 » A19130

$18.00

A19130
[A19130]

A19130
hg38 Position: ChrY:16148577..16148577
Ancestral: T
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: FGC7509_F CATGACTGGGATGGTGATTG
Reverse Primer: FGC7509_R GGCATGATCACAGCTCACAG
Reviews

Customers who bought this product also purchased
A19091
A19091
A19150
A19150
A19106
A19106
A19129
A19129
A19085
A19085
A19149
A19149
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y997
1 x FGC5948
1 x FGC5977
1 x Y9406
1 x AMM116
1 x Y13637
1 x Y993
1 x Y6958
1 x BY18375
$162.00
Haplogroup Info
Other products
Currencies