Top » Catalog » J2 » A19085

$18.00

A19085
[A19085]

A19085
hg38 Position: ChrY:7667744..7667744
Ancestral: T
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19085_F TCAGGGCCATAATTGGGTAG
Reverse Primer: A19085_R GATCTCGGCTCACTGCAAG
Reviews

Customers who bought this product also purchased
A19115
A19115
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19143
A19143
A19099
A19099
A19157
A19157
A19114
A19114
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies