Top » Catalog » J2 » A19085

$18.00

A19085
[A19085]

A19085
hg38 Position: ChrY:7667744..7667744
Ancestral: T
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19085_F TCAGGGCCATAATTGGGTAG
Reverse Primer: A19085_R GATCTCGGCTCACTGCAAG
Reviews

Customers who bought this product also purchased
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19143
A19143
A19099
A19099
A19157
A19157
A19114
A19114
A19136
A19136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15167
1 x Y13630
1 x Y13137
1 x L397
1 x Y16464
1 x A19091
1 x BY54613
1 x FT83442
1 x Y24492
1 x HU169
1 x PF5110
1 x PH3514
1 x PF7402
1 x FGC32689
$252.00
Haplogroup Info
Other products
Currencies