Top » Catalog » J2 » A19091

$18.00

A19091
[A19091]

A19091
hg38 Position: ChrY:9043766..9043766
Ancestral: C
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19091v2_F CATTCCTGAAGTCAGCAAGACAG
Reverse Primer: A19091v2_R CTCATGGCCACTGGGTCC
Reviews

Customers who bought this product also purchased
A19136
A19136
A19094
A19094
A19151
A19151
A19111
A19111
A19135
A19135
A19092
A19092
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH1751
1 x FGC32584
$36.00
Haplogroup Info
Other products
Currencies