Top » Catalog » J2 » A19091

$18.00

A19091
[A19091]

A19091
hg38 Position: ChrY:9043766..9043766
Ancestral: C
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19091v2_F CATTCCTGAAGTCAGCAAGACAG
Reverse Primer: A19091v2_R CTCATGGCCACTGGGTCC
Reviews

Customers who bought this product also purchased
A19101
A19101
A19158
A19158
A19115
A19115
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19143
A19143
A19099
A19099
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies