Top » Catalog » J2 » A19092

$18.00

A19092
[A19092]

A19092
hg38 Position: ChrY:9235191..9235191
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19092_F TTTTATTGTGGATGGTACGTTG
Reverse Primer: A19092_R GGAGGACAAGAGCTGCATTC
Reviews

Customers who bought this product also purchased
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19143
A19143
A19099
A19099
A19157
A19157
A19114
A19114
A19136
A19136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y12378
1 x FGC35418
1 x Y14435
1 x A19099
1 x HU226
1 x Y7706
1 x CTS8204
1 x SK1354
1 x FGC45075
$162.00
Haplogroup Info
Other products
Currencies