Top » Catalog » J2 » A19094

$18.00

A19094
[A19094]

A19094
hg38 Position: ChrY:10233024..10233024
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19094_F AAAAGAGAGTTTCAAAACAGCTCTACC
Reverse Primer: A19094_R GCTTTGAAACTCTCTTCCTGTGG
Reviews

Customers who bought this product also purchased
A19101
A19101
A19158
A19158
A19115
A19115
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19143
A19143
A19099
A19099
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y17027
1 x HU218
1 x S18238
1 x A24022
1 x Y992
1 x A19111
1 x BY188919
1 x HU217
1 x BY45507
1 x Y17001
1 x Y7010
1 x SK1376
$216.00
Haplogroup Info
Other products
Currencies