Top » Catalog » J2 » A19094

$18.00

A19094
[A19094]

A19094
hg38 Position: ChrY:10233024..10233024
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19094_F AAAAGAGAGTTTCAAAACAGCTCTACC
Reverse Primer: A19094_R GCTTTGAAACTCTCTTCCTGTGG
Reviews

Customers who bought this product also purchased
A19114
A19114
A19136
A19136
A19092
A19092
A19151
A19151
A19111
A19111
A19135
A19135
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies