Top » Catalog » J2 » A19111

$18.00

A19111
[A19111]

A19111
hg38 Position: ChrY:13021269..13021269
Ancestral: G
Derived: C
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19111_F TCTTTGTGGCTGTTGCAATG
Reverse Primer: A19111_R ACAGAAGCCGGAACCATTC
Reviews

Customers who bought this product also purchased
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19143
A19143
A19094
A19094
A19157
A19157
A19114
A19114
A19136
A19136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32592
1 x FGC45440
1 x CTS11100
1 x Y13675
1 x A24021
1 x L227
1 x HU198
1 x PF5183
1 x Y11291
$162.00
Haplogroup Info
Other products
Currencies