Top » Catalog » J2 » A19111

$18.00

A19111
[A19111]

A19111
hg38 Position: ChrY:13021269..13021269
Ancestral: G
Derived: C
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19111_F TCTTTGTGGCTGTTGCAATG
Reverse Primer: A19111_R ACAGAAGCCGGAACCATTC
Reviews

Customers who bought this product also purchased
A19130
A19130
A19085
A19085
A19149
A19149
A19101
A19101
A19129
A19129
A19079
A19079
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies