Top » Catalog » J2 » A19114

$18.00

A19114
[A19114]

A19114
hg38 Position: ChrY:13787245..13787245
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19114_F CTCCCACAGGGTCCTTCC
Reverse Primer: A19114_R AATATCACTAATGCAGCAATATACCTTGAC
Reviews

Customers who bought this product also purchased
A19150
A19150
A19091
A19091
A19106
A19106
A19130
A19130
A19149
A19149
A19085
A19085
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies