Top » Catalog » J2 » A19114

$18.00

A19114
[A19114]

A19114
hg38 Position: ChrY:13787245..13787245
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19114_F CTCCCACAGGGTCCTTCC
Reverse Primer: A19114_R AATATCACTAATGCAGCAATATACCTTGAC
Reviews

Customers who bought this product also purchased
A19101
A19101
A19129
A19129
A19079
A19079
A19147
A19147
A19099
A19099
A19158
A19158
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19130
1 x FGC64040
1 x Y15195
1 x F4326
1 x Y13640
1 x Y14399
1 x Y15193
1 x SK1327
1 x FGC5931
1 x Y21019
1 x L207
1 x A6103
1 x SK1353
1 x L230
1 x PF5111
$270.00
Haplogroup Info
Other products
Currencies