Top » Catalog » J2 » A19129

$18.00

A19129
[A19129]

A19129
hg38 Position: ChrY:15676942..15676942
Ancestral: A
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19129_F TTGTGGAAGACACCGTGTTG
Reverse Primer: A19129_R ATGGTATTCCCCATCCTGTG
Reviews

Customers who bought this product also purchased
A19114
A19114
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19143
A19143
A19094
A19094
A19157
A19157
A19111
A19111
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY15416
1 x Z27279
1 x BY7446
1 x BZ1548
1 x BY14150
$90.00
Haplogroup Info
Other products
Currencies