Top » Catalog » J2 » A19136

$18.00

A19136
[A19136]

A19136
hg38 Position: ChrY:17185654..17185654
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19136_F CTGACATAGGAGCCCAGGTG
Reverse Primer: A19136_R AGACTCAGTGGGACCTGCAC
Reviews

Customers who bought this product also purchased
A19115
A19115
A19079
A19079
A19147
A19147
A19099
A19099
A19158
A19158
A19114
A19114
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies