Top » Catalog » J2 » A19136

$18.00

A19136
[A19136]

A19136
hg38 Position: ChrY:17185654..17185654
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19136_F CTGACATAGGAGCCCAGGTG
Reverse Primer: A19136_R AGACTCAGTGGGACCTGCAC
Reviews

Customers who bought this product also purchased
A19094
A19094
A19157
A19157
A19111
A19111
A19135
A19135
A19092
A19092
A19151
A19151
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y11147
$18.00
Haplogroup Info
Other products
Currencies