Top » Catalog » J2 » A19147

$18.00

A19147
[A19147]

A19147
hg38 Position: ChrY:20044113..20044113
Ancestral: T
Derived: C
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19147_F TGCATCCACTCTCCAACAAG
Reverse Primer: A19147_R AGCTTAGGCCTGCATTTGAG
Reviews

Customers who bought this product also purchased
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19136
A19136
A19094
A19094
A19157
A19157
A19111
A19111
A19135
A19135
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies