Top » Catalog » J2 » A19158

$18.00

A19158
[A19158]

A19158
hg38 Position: ChrY:21288947..21288947
Ancestral: T
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19158_F TGCCTCACATGAAACTCTGG
Reverse Primer: A19158_R GTGACTGGGGAACTCTCAGG
Reviews

Customers who bought this product also purchased
A19111
A19111
A19135
A19135
A19092
A19092
A19150
A19150
A19108
A19108
A19130
A19130
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies