Top » Catalog » J2 » A19158

$18.00

A19158
[A19158]

A19158
hg38 Position: ChrY:21288947..21288947
Ancestral: T
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19158_F TGCCTCACATGAAACTCTGG
Reverse Primer: A19158_R GTGACTGGGGAACTCTCAGG
Reviews

Customers who bought this product also purchased
A19079
A19079
A19143
A19143
A19157
A19157
A19099
A19099
A19114
A19114
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z31551
1 x Y17027
1 x BZ1993
1 x Z42464
1 x BY38208
$90.00
Haplogroup Info
Other products
Currencies