Top » Catalog » J2 » A19158

$18.00

A19158
[A19158]

A19158
hg38 Position: ChrY:21288947..21288947
Ancestral: T
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19158_F TGCCTCACATGAAACTCTGG
Reverse Primer: A19158_R GTGACTGGGGAACTCTCAGG
Reviews

Customers who bought this product also purchased
A19115
A19115
A19079
A19079
A19143
A19143
A19099
A19099
A19157
A19157
A19114
A19114
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15933
1 x PF5119
1 x Y16839
1 x Y17070
1 x BY45501
1 x ALK659
1 x PH2758
$126.00
Haplogroup Info
Other products
Currencies