Top » Catalog » J2 » FGC21079

$18.00

FGC21079
[FGC21079]

FGC21079
hg38 Position: ChrY:8683822..8683822
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > L70 > CTS6061 > PF5456
Forward Primer: FGC21079_F TTTGGGTCTGACTGGAGGAG
Reverse Primer: FGC21079_R TAGGCTTGCAATCACCACAG
Reviews

Customers who bought this product also purchased
FGC21090
FGC21090
A19118
A19118
FGC21088
FGC21088
A19087
A19087
FGC21087
FGC21087
Y24651
Y24651
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1393
$18.00
Haplogroup Info
Other products
Currencies