Top » Catalog » J2 » FGC21079

$18.00

FGC21079
[FGC21079]

FGC21079
hg38 Position: ChrY:8683822..8683822
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > L70 > CTS6061 > PF5456
Forward Primer: FGC21079_F TTTGGGTCTGACTGGAGGAG
Reverse Primer: FGC21079_R TAGGCTTGCAATCACCACAG
Reviews

Customers who bought this product also purchased
Y24651
Y24651
A18941
A18941
FGC21081
FGC21081
FGC21094
FGC21094
J2-BY268-Kessler Panel
J2-BY268-Kessler Panel
FGC21080
FGC21080
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies