Top » Catalog » J2 » FGC21087

$18.00

FGC21087
[FGC21087]

FGC21087
hg38 Position: ChrY:14282172..14282172
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > L70 > CTS6061 > PF5456
Forward Primer: FGC21087_F TGCATTGGACATTACATGGTG
Reverse Primer: FGC21087_R CTGTCTGACAATCCCCAGTG
Reviews

Customers who bought this product also purchased
FGC21079
FGC21079
FGC21092
FGC21092
FGC21077
FGC21077
FGC21090
FGC21090
A19118
A19118
FGC21088
FGC21088
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies