Top » Catalog » J2 » Y22315

$18.00

Y22315
[Y22315]

Y22315
hg38 Position: ChrY:6825099..6825099
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2
Comments: Below Y22056
Forward Primer: Y22315_F TCTCACTAGTGGTCTATCAATTTTGC
Reverse Primer: Y22315_R TTGGCTCAAGGATGAAATGG
Reviews

Customers who bought this product also purchased
Y29723
Y29723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y23094
1 x SK1363
1 x FGC33284
1 x A22133
1 x Y17023
1 x Y17029
1 x A24019
$126.00
Haplogroup Info
Other products
Currencies