Top » Catalog » J2 » B440

$18.00

B440
[B440]

B440
hg38 Position: ChrY:2899688..2899688
Ancestral: G
Derived: A
Reference: Karmin et al. (2015)
ISOGG Haplogroup: J2b2a1a1a1a
Comments: Below L283 > Z584 > Z1297
Forward Primer: B440_F GACTGCCACAGCCAACATAC
Reverse Primer: B440_R TCTCCTGGGTCCTACAGGG
Reviews

Customers who bought this product also purchased
Y36194
Y36194
YP136
YP136
Z1297
Z1297
Y23095
Y23095
Y36202
Y36202
M241
M241
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies