Top » Catalog » J2 » B440

$18.00

B440
[B440]

B440
hg38 Position: ChrY:2899688..2899688
Ancestral: G
Derived: A
Reference: Karmin et al. (2015)
ISOGG Haplogroup: J2b2a1a1a1a
Comments: Below L283 > Z584 > Z1297
Forward Primer: B440_F GACTGCCACAGCCAACATAC
Reverse Primer: B440_R TCTCCTGGGTCCTACAGGG
Reviews

Customers who bought this product also purchased
FT204243
FT204243
Y36206
Y36206
BY124398
BY124398
Y106260
Y106260
Y23095
Y23095
Y36202
Y36202
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies