Top » Catalog » J2 » PH1080

$18.00

PH1080
[PH1080]

PH1080
hg38 Position: ChrY:12156217..12156217
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2b
Comments: Below L283 > Z8424
Forward Primer: PH1080_F TTTATATACTTTCGGTGTGCAACTG
Reverse Primer: PH1080_R GAGGCTTCATCTGCCTCATG
Reviews

Customers who bought this product also purchased
Y26712
Y26712
Y92225
Y92225
Y12005
Y12005
Y145905
Y145905
Z1043
Z1043
Y105578
Y105578
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15508
1 x S9519
1 x Y13656
1 x Y21525
1 x Y16944
1 x SK1385
1 x Y20316
1 x HU208
$144.00
Haplogroup Info
Other products
Currencies