Top » Catalog » J2 » CTS6521

$18.00

CTS6521
[CTS6521]

CTS6521
hg38 Position: ChrY:14851020..14851020
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2a
Comments: Below L25
Forward Primer: CTS6521_F GCAGTGTTGCAATCTTGGAG
Reverse Primer: CTS6521_R TCATCCTCATCCTCATCATCAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC20437
1 x A11793
1 x CTS1225
1 x PF5196
1 x A5360
1 x Y14375
1 x FGC61398
1 x Y13668
1 x S11868
1 x FGC6758
1 x CTS3617
$198.00
Haplogroup Info
Other products
Currencies