Top » Catalog » J2 » CTS6521

$18.00

CTS6521
[CTS6521]

CTS6521
hg38 Position: ChrY:14851020..14851020
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2a
Comments: Below L25
Forward Primer: CTS6521_F GCAGTGTTGCAATCTTGGAG
Reverse Primer: CTS6521_R TCATCCTCATCCTCATCATCAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies