Top » Catalog » J2 » A22133

$18.00

A22133
[A22133]

A22133
hg38 Position: ChrY:21610971..21610971
Ancestral: C
Derived: T
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: A22133_F TCTCTTTTGAAATTTTGTGACTCAATC
Reverse Primer: A22133_R GGCATCAGATGCACAACAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S51
1 x FGC33286
1 x Z3610
1 x FGC5904
1 x BZ384
1 x Y7313
1 x Y20058
1 x M2525
$144.00
Haplogroup Info
Other products
Currencies