Top » Catalog » J2 » A22133

$18.00

A22133
[A22133]

A22133
hg38 Position: ChrY:21610971..21610971
Ancestral: C
Derived: T
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: A22133_F TCTCTTTTGAAATTTTGTGACTCAATC
Reverse Primer: A22133_R GGCATCAGATGCACAACAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
1 x A22313
1 x A24018
1 x S399
1 x Y16955
1 x Y16904
1 x Y12371
1 x PF4941
1 x FGC22278
1 x HU197
1 x FGC30368
$234.00
Haplogroup Info
Other products
Currencies