Top » Catalog » J2 » BY45498

$18.00

BY45498
[BY45498]

BY45498
hg38 Position: ChrY:2951618..2951618
Ancestral: C
Derived: T
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: BY45498_F GGCATTACAAGACCCCCTTC
Reverse Primer: BY45498_R TCCAAGGTTTCACATTCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies