Top » Catalog » J2 » BY45498

$18.00

BY45498
[BY45498]

BY45498
hg38 Position: ChrY:2951618..2951618
Ancestral: C
Derived: T
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: BY45498_F GGCATTACAAGACCCCCTTC
Reverse Primer: BY45498_R TCCAAGGTTTCACATTCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16313
1 x FGC47760
1 x Y14568
1 x Y11782
1 x CTS494
1 x Y15052
1 x L207.1
1 x PF5191
1 x FGC4992
1 x P354
1 x CTS3307
1 x FGC15782
1 x Y14563
1 x Y998
1 x M260
$270.00
Haplogroup Info
Other products
Currencies