Top » Catalog » J2 » BY45499

$18.00

BY45499
[BY45499]

BY45499
hg38 Position: ChrY:7377824..7377824
Ancestral: A
Derived: G
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: BY45499_F TTGGAGCTGTTTTTCCAAGC
Reverse Primer: BY45499_R GACCTCCTCAGGCTCAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y17027
1 x HU218
1 x S18238
1 x A24022
1 x Y992
1 x A19111
1 x BY188919
1 x HU217
1 x BY45507
1 x Y17001
1 x Y7010
1 x SK1376
1 x SK1359
1 x FGC35702
1 x FGC29950
1 x Y14581
1 x Y14407
1 x FGC30289
1 x Y20554
1 x Y9409
1 x Y17008
1 x Y13667
1 x FGC23229
$414.00
Haplogroup Info
Other products
Currencies