Top » Catalog » J2 » BY45501

$18.00

BY45501
[BY45501]

BY45501
hg38 Position: ChrY:8005382..8005382
Ancestral: T
Derived: G
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: BY45501_F TTGGAGAAAGGCCCAGATAG
Reverse Primer: BY45501_R TCCCAAAGTGCTGGGATTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH1244
1 x FGC30303
1 x Y15178
1 x FGC21085
1 x HU219
1 x Y18039
$108.00
Haplogroup Info
Other products
Currencies