Top » Catalog » J2 » BY45504

$18.00

BY45504
[BY45504]

BY45504
hg38 Position: ChrY:17038307..17038307
Ancestral: G
Derived: C
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: BY45504_F TCTGCAGCCTTGACAATGAC
Reverse Primer: BY45504_R TGATGGTGTTTCCAGAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y14434
1 x Y17408
1 x FGC30343
1 x PF5380
1 x FGC6738
1 x Y15169
1 x PF4275
1 x Y12622
1 x BY24003
1 x PF5294
1 x A19079
1 x FGC20254
1 x Y12594
1 x FGC32591
1 x M12
1 x A12503
$288.00
Haplogroup Info
Other products
Currencies