Top » Catalog » J2 » BY45504

$18.00

BY45504
[BY45504]

BY45504
hg38 Position: ChrY:17038307..17038307
Ancestral: G
Derived: C
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: BY45504_F TCTGCAGCCTTGACAATGAC
Reverse Primer: BY45504_R TGATGGTGTTTCCAGAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies