Top » Catalog » J2 » BY45505

$18.00

BY45505
[BY45505]

BY45505
hg38 Position: ChrY:19103926..19103926
Ancestral: G
Derived: T
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: BY45505_F AGGAGGGCCTTAGAATGGAC
Reverse Primer: BY45505_R CCCAAACCATCAAAAAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32683
1 x Y14436
1 x Y20339
1 x L283
1 x PH3882
1 x FGC5911
1 x A11792
1 x A12378
1 x AMM136
1 x SK1378
1 x FGC4977
1 x L192.2
1 x Y13893
1 x PH1602
1 x PH1089
$270.00
Haplogroup Info
Other products
Currencies