Top » Catalog » J2 » FGC4977

$18.00

FGC4977
[FGC4977]

FGC4977
hg38 Position: ChrY:14071036..14071036
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J2a
Comments: Below L25 > PF5368 > L254
Forward Primer: FGC4977_F TCACTTTTTCAAATGATTCTCTGG
Reverse Primer: FGC4977_R GGTTTGACAGAGGGACACATAATTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
1 x FGC20423
1 x Y7008
1 x Y15174
$72.00
Haplogroup Info
Other products
Currencies