Top » Catalog » J2 » A21931

$18.00

A21931
[A21931]

A21931
hg38 Position: ChrY:12573888..12573888
Ancestral: C
Derived: T
Reference: YSEQ (2018)
ISOGG Haplogroup: J2
Comments: PF5172 > FGC16096 > L433 > Z40068 > Y20566
Forward Primer: A21931_F GTCTCAGCCTAAAGTCTCCTTAAGG
Reverse Primer: A21931_R AGGTAGCATGATGCCTCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12499
1 x A13164
1 x A12450
1 x FGC17733
1 x L210
1 x FGC30508
1 x Y9011
1 x Y23722
1 x FGC52116
1 x M67
1 x Y23095
1 x Y8497
1 x Y13647
1 x Y15238
1 x SK1342
1 x Y7708
1 x SK1395
1 x FGC31969
$324.00
Haplogroup Info
Other products
Currencies